Asterisk perl prepaid işler

Filtre

Son aramalarım
Şuna göre filtrele:
Bütçe
ile
ile
ile
Tür
Beceri
Diller
    İş Durumu
    36,101 asterisk perl prepaid iş bulundu, ücretlendirmeleri EUR

    ...MUST work without having to change security. MUST WORK with out having to loosen the permissions to file:666 and dir:777, My other webpage based adduser etc... solutions in perl are working fine, there is no reason for this one not to also. 4.) Only one user name has to be entered at a time. Only the user name is required. No password will be entered

    €41 (Avg Bid)
    €41 Ortalama Teklif
    2 teklifler

    I need a perl script that processes a form and saves the input in a tab or comma delimeted format on the server. It then emails this file(if there are new entries) to a secretary, and deletes the old file. The form can be found at [login to view URL] ## Deliverables Complete source code of all programming work done ## Deadline information

    €30 (Avg Bid)
    €30 Ortalama Teklif
    1 teklifler
    Submission Bitti left

    I need a perl website submission script. It must be easy to read/edit for me (I have been playing/studying perl for 3 months now). I want 2 texboxes, the one on the left will display ALL search engines they can submit to. The one on the left will display the engines they select to submit to. When an engine is selected, it is removed from the left and

    €150 (Avg Bid)
    €150 Ortalama Teklif
    9 teklifler

    Need help to make this script receive user name from a web page and restore their access. [login to view URL] ## Deliverables Complete source code of all programming work done

    €41 (Avg Bid)
    €41 Ortalama Teklif
    7 teklifler

    We are currently looking for PHP and Perl programmers who have had working commercial experience specifically related to site tracking, search engines and marketing projects. LONDON AREA ONLY Please send CV and any examples of work to: [login to view URL]@[login to view URL]

    €178 - €268
    Mühürlü
    €178 - €268
    0 teklifler

    We are currently looking for PHP and Perl programmers who have had working commercial experience specifically related to site tracking, search engines and marketing projects. Please send CV and any examples of work to: [login to view URL]@[login to view URL]

    €178 - €268
    Mühürlü
    €178 - €268
    0 teklifler
    Signup Page Bitti left

    ...potential customers. I need to create an on-line signup page. I already have a web based adduser that is used locally that adds users to the server instantly. The script is in perl. Can be integrated in to this one if need be. Stand alone is fine also. To be mentioned if included or not with bid. Instruction and guidance to set server to allow preset login

    PHP
    €388 (Avg Bid)
    €388 Ortalama Teklif
    7 teklifler
    Perl Database Bitti left

    ...designed in perl which has the following features. Members login: one for guest:guest, one for paid members which they will create login:pass. All information for paid members will be stored on file and retrieved when login. No information, no anything, is saved for guest:guest users. When they login to either script, they will be able to use a perl-based

    €36 (Avg Bid)
    €36 Ortalama Teklif
    7 teklifler

    Well, I want a...[login to view URL] ## Deliverables I would need you to code all the scripts needed for this package and if you need i'll take care of the design. I mainly want this in PHP or Perl because its for the unix server but would also consider ASP or JSP package for my NT server. ## Deadline information Best price will win the auction.

    €721 (Avg Bid)
    €721 Ortalama Teklif
    16 teklifler

    ...probably a 10 minute job for the right person, but that person is not me. All I need to do is get the dynamic html of a site... thats it. I can do it easily with a browser but my perl script won't yet do the job. The site is https, requires a login and uses cookies/session key. The content is generated from a database (sql?) and is specific to my login. I

    €52 (Avg Bid)
    €52 Ortalama Teklif
    3 teklifler

    I run Linux Slackware 7.1 kernel 2.4.5 Need to create sign up for potential customers from hand out floppy disk. Perl or C++ prefered. I was told to have a standard user name and password on our system that will not allow access beyond the server if they use dial-in for signup. I can program our install disk to a default user name and password and web

    PHP
    €1327 (Avg Bid)
    €1327 Ortalama Teklif
    3 teklifler

    ...for admin (only), and get replies from admin (only). User may only see messages he/she has left (same for replies from admin). We currently have this on our site (done in cgi/perl)...but would like a better interface. Bid on BRAND NEW or RE-DO of current. Must be password/userid protected (assignment by Admin.) Flat file preferred, we are a "virtual"

    €222 (Avg Bid)
    €222 Ortalama Teklif
    16 teklifler

    ...provide services in the feild Cold Fusion, JSP, ASP, PHP, DHTML, XML, Java, RDBMS(Oracle, SQL Server, MySQL, Informix, Sybase), RDBMS Connectivity (Dbtools, JDBC, ODBC), CGI (Perl, C++) {in both linux and Win NT platform}, Javascript, Javabeans etc. We have also got expertise in animation with Flash, Photoshop, Dreamweaver, Director, etc. Thanks / Regards

    €178 - €268
    Mühürlü
    €178 - €268
    0 teklifler

    Make changes to existing code utilized on our website. CGI/Perl. Mostly just minor changes, can't locate the original programmer! :( Need: revisions to form handling. revisons to user log-in area...(keep log-in, just change where it goes afer log-in is complete). ## Deliverables Complete source code of all programming work done installation of new

    €101 (Avg Bid)
    €101 Ortalama Teklif
    16 teklifler

    ...inform you that we specialise in Cold Fusion, JSP, ASP, PHP, DHTML, XML, Java, RDBMS(Oracle, SQL Server, MySQL, Informix, Sybase), RDBMS Connectivity (Dbtools, JDBC, ODBC), CGI (Perl, C++) {in both linux and Win NT platform}, Javascript, Javabeans etc. We have also got expertise in animation with Flash, Photoshop, Dreamweaver, Director, etc. We are looking

    €178 - €268
    Mühürlü
    €178 - €268
    0 teklifler

    has anyone successfully installed adcenter 2000 on an NT server? I just purchased a copy of it for a site I'm working on, and it doesn...of it for a site I'm working on, and it doesn't seem to work. Don't even know where to start on an estimate for this one, I'm open to ideas. Thanks ## Deliverables working perl script propperly installed on server

    €102 (Avg Bid)
    €102 Ortalama Teklif
    2 teklifler

    Need a script to accomplish the following: a. ability t...check credit card for funds using [login to view URL] h. user gets a confirmation e-mail with username/password with instructions and a welcome message i. site hosted on freebsd (perl/cgi no asp) j. customer has merchant account Project to be completed by: no later than Aug. 28th or 29th, 2001

    €268 (Avg Bid)
    €268 Ortalama Teklif
    1 teklifler

    ...to be nothing fancy we have all the documentation on how the XML feeds work. We need something that is inexpensive! And would like a developer that can do it and understands PERL. Our goal is to do this, and then give other small modification to this developer, in effect creating a relationship with this developer to do other work....

    €9 (Avg Bid)
    €9 Ortalama Teklif
    1 teklifler

    Hi; I need a Perl coder/coders for some MODs I need done to a perl forum script. The actual program is UltraBoard 2000 2.23, which should be fairly generic code for any perl programmer. I can live with most of the out-of-package features, but there are specific mods that I would like. You can get a better idea by checking out my board at: http://207

    €95 (Avg Bid)
    €95 Ortalama Teklif
    2 teklifler

    We have a simple web sight going up soon, we are going to go the ASP route rather than perl/cgi scripts as it looks like in the near future we will definitely be adding things on to it. (i.e. Passwords facility, chat room/ discussion forum, faults database and technical support) So for the time being we would like a quote and time schedules on setting

    €178 - €268
    Mühürlü
    €178 - €268
    0 teklifler

    Im I need of a very basic Web based Project Managment Application. This must be completed using Perl or PHP with MySQL. Required features: Admin page: Allows you to view, create, delete projects. (When creating a new project, a new directory must be made in the root web dir and all files for project placed in the newly created dir. When deleting a project

    €108 (Avg Bid)
    €108 Ortalama Teklif
    10 teklifler

    Perl/CGI Script to allow clients to run this search from our site with the results returned on our site: [login to view URL] No reformating of the output is necessary, with the exception of a secondary link. Our site is using windows nt with microsoft front page installed.

    €45 (Avg Bid)
    €45 Ortalama Teklif
    1 teklifler

    Looking for a true expert/genius in Javascript, HTML & all internet programming tools NOT requiring private hosting resources ( such as PHP, PERL etc ). Looking for someone familiar with non-documented functions&tricks able to work 100% cross-browser ( IE/NS 3,0+ ). Someone able to go far beyond everyday's know-how. Someone able to seek AND find, not

    €85 (Avg Bid)
    €85 Ortalama Teklif
    10 teklifler

    Need installation and testing/debugging of a pre-existing script Also, installation of any necessary modules (LPW) and setup of perl cgi.

    €45 (Avg Bid)
    €45 Ortalama Teklif
    1 teklifler

    ...development module working. The ALPHA of the product development module was written with limited functionallity in PERL. The first task of the project is a re-write of this application in KYLIX. You can see an example of the work in PERL here, from a CLIENT LOGIN perspective. [login to view URL] username: demo1 password: wercit968 The product development

    PHP
    €1539 (Avg Bid)
    €1539 Ortalama Teklif
    3 teklifler

    Send / Recieve mail directly from AOL servers using perl and linux. I provide Example Files: [login to view URL] contains 10 aol usernames (ScreenNames) one per line delimited by newlines. [login to view URL] contains a 300 Char Text Message. you will create: [login to view URL] a simple perl script that is easy to read and modify sendaolmail contains the following

    €89 - €446
    €89 - €446
    0 teklifler

    ...description). after purchasing script package from [login to view URL] and sharing my idea, he suggested I visit this site. ( I am using windows, but my domain is located where I can use perl-cgi/unix scripts.) Anyhow, I see lots of banner exchange scripts and rotating quote of the day type scripts ... but since our web sites could become overloaded with banners

    €89 (Avg Bid)
    €89 Ortalama Teklif
    1 teklifler

    Hello, I wish to display the filesize next to each file printed in the array below Please note - the 2 array symbols are now an astrisk to allow me to send this email here at rent a coder.... I tried $ENV{'CONTENT_LENGTH'}hoping to do just that but had no luck? I would be gratefull if one of you pro's could help me add this tid bit to my view sub below, so that I may learn what I wa...

    €13 (Avg Bid)
    €13 Ortalama Teklif
    3 teklifler

    Hello! I wish to display the filesize next to each file printed in the array below Please note - the 2 array symbols are now an astrisk to allow me to send this email here at rent a coder.... I tried $ENV{'CONTENT_LENGTH'}hoping to do just that but had no luck? I would be gratefull if one of you pro's could help me add this tid bit to my view sub below, so that I may learn what I wa...

    max €4
    max €4
    0 teklifler
    database Bitti left

    Hi guys Need some advice about how to conect a site to a database. I know the basics but it still w...some advice about how to conect a site to a database. I know the basics but it still won't work. I have Mysql on the server i just need to know the corect syntacs for either perl or asp.. Please email me if you can help. [login to view URL]@[login to view URL]

    €178 - €268
    Mühürlü
    €178 - €268
    0 teklifler

    Need a perl or other type of script that can run when a user clicks on a link. THe script must ping a server and direct the browser to the server if up, else redirect to another server. ## Deliverables Complete source of all code including any HTML ## Deadline information Done by Aug 15.

    €37 (Avg Bid)
    €37 Ortalama Teklif
    2 teklifler

    (This is a repost as the original coder was unable to do the work.) I have a banner exchange script I need debugged and modified. The script is written is cgi/perl. ## Deliverables The modifications I need are "referral levels added to the script. I need a minimum of 5 levels, with each level receiving a percentage of each levels impressions/page

    €35 (Avg Bid)
    €35 Ortalama Teklif
    3 teklifler

    ...template for a very simple home-based store front web site. Create "look-and-feel" for a simple shopping cart application including site logo and other graphics. Site will be Perl (maybe PHP based) using templates, so deliverables should be geared towards reusability. ## Deliverables * All graphics for site (simple good-looking graphics OK) * Just

    €137 (Avg Bid)
    €137 Ortalama Teklif
    13 teklifler

    ...records. We will need to add and retrieve records through text boxes and drop down boxes. Some sorting options will be required. I would like this to be set up with MySQL. PHP or perl may be the best compliment, I'm unsure. Both can be available. We are setting this up for one customer with many stores in order to verify that our contracted work with them

    PHP
    €189 (Avg Bid)
    €189 Ortalama Teklif
    2 teklifler

    Hello, We are currently looking for Perl programmers to help develop open source and commercial CGI products. You must have reasonable knowledge in any of the following areas: Perl Javascript Advanced HTML We would prefer it if you had previous experience at programming full products but it is not required. Programmers would benefit from a profit share

    €178 - €268
    Mühürlü
    €178 - €268
    0 teklifler

    ...design with functionality and ease of use. I don't want to accept orders through the site, so no credit card or shopping cart facilities are req'd, and you need not know CGI, Perl or Java as it is not also req'd. Maybe a short 10sec flash intro with our name in sleek writing. I need approximately 10 pages with a little content and a template that I can

    €178 - €268
    Mühürlü
    €178 - €268
    0 teklifler

    i would like you to write a perl or c script to list all the weblogs in a directory (in apache customlog fmt) then i can click one log name and then get a table listing of the last 100K lines of said weblog, then a table will appear with the last few dates across the top row, under that would be a sorted hit/referrer report under each date column..

    €37 (Avg Bid)
    €37 Ortalama Teklif
    5 teklifler

    a script in either php or perl with mysql that's a clone of [login to view URL] with all thier features ## Deliverables Complete source code of all programming work done proof that it works

    €1464 (Avg Bid)
    €1464 Ortalama Teklif
    5 teklifler

    I have a banner exchange script I need debugged and modified. The script is written is cgi/perl. ## Deliverables The modifications I need are "referral levels added to the script. I need a minimum of 5 levels, with each level receiving a percentage of each levels impressions/page views. Percentages as follows level 1 = 10% level 2 = 5% level 3 =

    €46 (Avg Bid)
    €46 Ortalama Teklif
    1 teklifler

    ...all the time. Capital Creations current site [login to view URL] Correction - I just recently discovered that my host does not support asp. It does support cgi, perl, and mysql. So if there is a way that you can do the uploading of a project through the webpage with one of these languages then that is what I need. ## Deliverables Website

    €1052 (Avg Bid)
    €1052 Ortalama Teklif
    27 teklifler
    A quick sort Bitti left

    ...determine if the number should be sorted in ascending or descending order. Then, show the use of polymorphism with two classes, an invoice class and a sales order class (in PERL) ## Deliverables Complete source code of all programming work done ## Deadline information I needed it 20 minutes ago, the last guy bid,i accepted and paid, then he never

    €7 (Avg Bid)
    €7 Ortalama Teklif
    1 teklifler

    [login to view URL], Inc. (Mindbridge) has expressed the desire to enhance its IntraSmart software product offering by providing its clients with the...with new sychronization of the fore-mentioned software. ## Deadline information coder must have Full knowledge of all primary program languages especially, HTML, C++, Java, Perl, PHP, Visual Basic, Etc.

    €6789 (Avg Bid)
    €6789 Ortalama Teklif
    3 teklifler

    I need a script that will pull email addresses and names from a mysql file and mass mail to 1000's of people which works in the backgroud with a confirmation after the mailing to let me know that it is done ## Deliverables The code must include a htlp form in which to enter the subject, body and from email address beofre sending the mailing. The mysql file is already in use and this script...

    €61 (Avg Bid)
    €61 Ortalama Teklif
    5 teklifler

    Hello, I am new at PERL and over the last month have produced a script to help me organize a single users data. Two things still need to be fixed. 1. The script is processing "" semi quotes and such entered in on the edit form. (This is currently hardcoded and simply opens a text file and overwrites it) How can I prevent this from occuring? 2. My showdates

    €19 (Avg Bid)
    €19 Ortalama Teklif
    2 teklifler

    ...that need to set up on server. Many of them will be redirected to various pages of my search engine program. Would be great if could find someone familiar with Apache, webmin, Perl/CGI and MSQL so could help develope and advise as project evolves. Looking for someone to teach me how to use webmin, and help me set up via phone consultation at hourly rate

    €89 (Avg Bid)
    €89 Ortalama Teklif
    1 teklifler

    I need a program that starts with two parents parent1:TCGAGTGCCTCGATGACTAT parent2:GTTTTGGCAACAATGTAGGG This program should use a random method of choosing between crossover,mutation, and reporduction. Reproduction just simply compies the genetic code to the two children. Mutation basically mutates the genes and crossover, take half the genes, splits them and then combines them with the other chil...

    €129 (Avg Bid)
    €129 Ortalama Teklif
    4 teklifler

    I am looking for a browser based web site application, (i.e. [login to view URL]) ...administration from solutionscripts homefree, plus the ease of use from homestead for the browse/client. I run a Unix with custom redhat, on Apache. I suppose it would be written in Perl or PHP. ## Deliverables Complete source code of all programming work done

    €841 (Avg Bid)
    €841 Ortalama Teklif
    12 teklifler

    The messaging system should be in format like ICQ or AIM. The server end will be on a UNIX server(I prefer to have the server side in PERL) and should have to do as little as possible. The UNIX server should be able to be a normal virtual server (Hosted at a web hosting company and not in house). The features should include but are not limited to file

    €208 (Avg Bid)
    €208 Ortalama Teklif
    4 teklifler

    ...newsletter, and set admin variables). This script will eventually become part of a much larger project, and the right person will receive more jobs later. Please, do not submit Perl or ASP proposals - this is a PHP ONLY project. ## Deliverables Full script with documentation, step by step install information, and I own the rights to the script. ##

    €319 (Avg Bid)
    €319 Ortalama Teklif
    24 teklifler
    Daily email Bitti left

    I need a shell/perl script that is running via crontab (on Linux machine) once a day and what sends out email(s). ## Deliverables Desired features: Every day the script is executed via crontab. The script should do following: * check if there is a file called /emails/[login to view URL] (####.##.##.txt) * if file does not exist - do nothing

    €68 (Avg Bid)
    €68 Ortalama Teklif
    13 teklifler