Collating data analysis işler

Filtre

Son aramalarım
Şuna göre filtrele:
Bütçe
ile
ile
ile
Tür
Beceri
Diller
    İş Durumu
    116,230 collating data analysis iş bulundu, ücretlendirmeleri EUR

    Comparative statistic analysis, equilibrium analysis, matrix algebra üzerine basit sorulardan oluşan online sınav konusunda yardıma ihtiyacım var.

    €19 (Avg Bid)
    €19 Ortalama Teklif
    1 teklifler

    Konu: Discuss the transformation of the Roman Empire in late antiquity and the role of religion in that transformation. What were the ways in which the rise of Christianity and later the rise of Islam contributed to the transition from antiquity to the middle ages? Provide an answer based on close textual analysis of the required readings. Use at least three or more of the required readings. Compa...

    €25 (Avg Bid)
    €25 Ortalama Teklif
    6 teklifler
    €90 Ortalama Teklif
    11 teklifler

    Twitter üzerinden Türkçe Tweetler çekilerek elde edilen veri setini kullanarak bir ürün, şirket yada markaya dair kamuoyu duygularını analiz edebilen SENTIMENT ANALYSIS (Duygu Analizi) uygulama geliştirilmesi (pozitif, negatif, nötr olarak sınıflandırma gerçekleştirecek). Makine öğrenmesi algoritmalarından faydalanılacaktır. Veri madenciliği, NLP ...

    €1391 (Avg Bid)
    €1391 Ortalama Teklif
    8 teklifler

    ---------------------------------------------------------------------TURKISH--------------------------------------------------------------------------------------- evlilik - arkadaşlık sitesi yaptırılacaktır, Özellikleri online kameralı görüşme istenilen kişiye resim gösterme psikolojik analiz ve uyumluluk testi telefonların konum servisleri ile yakınındaki kişileri b...

    €9 / hr (Avg Bid)
    €9 / hr Ortalama Teklif
    1 teklifler

    I am looking for business proposal draft for my business pitch. The content needed are marketing validation, financial projection, competitor analysis. Would like to seek for your advice

    €2160 (Avg Bid)
    €2160 Ortalama Teklif
    1 teklifler

    I want an expert in power system analysis to help me with my project. and he must know the power world program so well

    €134 (Avg Bid)
    €134 Ortalama Teklif
    5 teklifler

    I need someone who can pull data (need to write a code in python to pull the data from the website and automate it). once you have the data then you need to analyze it, I will discuss those points in PM and finally prepare the presentation and provide recommendations. Thanks

    €72 (Avg Bid)
    €72 Ortalama Teklif
    9 teklifler

    I am badly in need of someone who can convert written images to PDF documents I will pay such person very well

    €294 (Avg Bid)
    €294 Ortalama Teklif
    18 teklifler

    I need a professional who can handle microsoft word packages and power point presentation including excel packages, to handle office files

    €324 (Avg Bid)
    €324 Ortalama Teklif
    14 teklifler

    You need to be familiar with sorting algorithms, their time complexity, analysis etc. 1. Algorithms (definition, analysis, complexity etc.). 2. Sorting including mergesort, quicksort, heapsort and related questions like heapification etc. 3. Dynamic programming algorithms including knapsack, matrix chain, longest common subsequence, transitive closure, recurrences.

    €59 (Avg Bid)
    €59 Ortalama Teklif
    10 teklifler

    GET ME A TOOL FOR FORENSIC ANALYSIS WHICH WILL GET ME THE BROWSER DATA FROM RAM

    €422 - €843
    €422 - €843
    0 teklifler

    Milestone1: Upto 2-3 Pages It should contain the following. 1. Project charter 2. Problem statement – Existing problem or Goal statement – New / Idea 3. Business case Why is this project worth doing now? What are the consequences of not doing this project? Declare processes on the basis of priority (high , medium & low). It shoul...

    €60 (Avg Bid)
    €60 Ortalama Teklif
    5 teklifler

    Lütfen detayları görmek için Kaydolun ya da Giriş Yapın.

    Gizlilik Anlaşması

    Hi, I’m looking for an expert in statistics and especially operations research, he or she need to be available immediately to help solve problems in operations research related to the following topics and concepts: - Linear programming - Sensitivity analysis - Graphical method - Simplex method - Shadow price - Dual problems - Binding & non-binding constraints Must be expert in the menti...

    €40 (Avg Bid)
    €40 Ortalama Teklif
    8 teklifler

    We are a newly launched startup, based out of Bangalore in India. We are creating a premium silver jewelry D2C brand and our website has just been launched. Seeking a digital marketeer with experience in jewelry e-commerce or at the least in the lifestyle space to help us with our digital marketing. We are looking for support in paid marketing through social media marketing and Google SEM. This ...

    €253 (Avg Bid)
    €253 Ortalama Teklif
    7 teklifler

    In a paragraph: -------------- There are a lot of software robots trying to access the servers in the Internet without permission. It is neccesary to make an application running continuously in the server to be a guard of what is happening related to attacks, work-load and unauthorized access to the server. Server characteristics: --------- Hardware: CPU: Intel(R) Xeon(R) CPU E3-1270 v6 @ 3.80GHz...

    €30 (Avg Bid)
    €30 Ortalama Teklif
    1 teklifler

    Statistical analysis is needed to be done for a secondary database, which needs descriptive statistical analysis to see the relationship between dependent and independent variables, also Chi-square tests and Logistic regression analysis. For a cross-sectional study in malnutrition.

    €96 (Avg Bid)
    €96 Ortalama Teklif
    22 teklifler
    Finance project 6 gün left
    ONAYLI

    I want someone expert in finance to do a financial analysis of 4 companies , the data will be provided to you , all you have to do is analyze the data and present the findings , this is small task of max budget $10

    €13 (Avg Bid)
    €13 Ortalama Teklif
    11 teklifler
    Article analysis 6 gün left
    ONAYLI

    Article analysis following certain criteria.

    €18 (Avg Bid)
    €18 Ortalama Teklif
    29 teklifler

    What is required? - Writing bibliometric article (similar to the model paper) with the same structure - Key words: o Digitization; Internationalization; Science Mapping; Bibliometric Analysis; Content Analysis; International Business - Introduction Research Question: What are the research perspectives dealing with digitization and internationalization? In order to answer the research question: ...

    €85 (Avg Bid)
    €85 Ortalama Teklif
    20 teklifler

    The Master’s thesis is “Social Media and Society” and its title is: The impact of digital opinion leadership on political interest and participation in post-dictatorship Tunisia. I will provide the part of the thesis which is made up of the introduction and the literature review for better understanding of the research questions and the scope of the explored possible results. I w...

    €178 (Avg Bid)
    €178 Ortalama Teklif
    13 teklifler
    sistema ERP 6 gün left

    Hi, At this moment we have a system developed in Java with spring, hibernate and jpa with a database in MySQL, which allows us to add, modify products with simple data such as code, barcode, purchase price,% of profit, per family o type of product and supplier and a simple inventory. Customers and suppliers with simple data such as address and personal data, accounts receivable with receipts, use...

    €3865 (Avg Bid)
    €3865 Ortalama Teklif
    5 teklifler

    I need a BA to research all the AI Categories and Sub Categories for a Artificial Intelligence website. Also help with website copy.

    €83 (Avg Bid)
    €83 Ortalama Teklif
    20 teklifler

    Use the data to conduct profitability comparative analysis Use software modeling to do linear regression analysis. Need methodology and result discussion

    €113 (Avg Bid)
    €113 Ortalama Teklif
    15 teklifler

    Looking for an Analyst to analyse a dataset and answer two questions, one in SQL and the other in Python and provide results in a precise and clear presentation. This is a one time project and would need a smart analyst to handle the project.

    €23 (Avg Bid)
    €23 Ortalama Teklif
    5 teklifler

    Logistic regression report, including: - Introduction - Exploratory analysis - From initial to final model - Results - Comments about the data/analysis - Interpretation and conclusions for a lay audience

    €158 (Avg Bid)
    €158 Ortalama Teklif
    27 teklifler

    GET ME A TOOL FOR FORENSIC ANALYSIS WHICH WILL GET ME THE BROWSER DATA FROM RAM

    €17 - €141
    €17 - €141
    0 teklifler

    GET ME A TOOL FOR FORENSIC ANALYSIS WHICH WILL GET ME THE BROWSER DATA FROM RAM

    €17 - €141
    €17 - €141
    0 teklifler

    I have a data analysis task.i am very honest

    €3 / hr (Avg Bid)
    €3 / hr Ortalama Teklif
    7 teklifler
    Static Analysis 6 gün left

    Hi everyone, I need your help to create static analysis in Ansys Workbench. The motorcycle design was already meshed. The tasks will be, For the first time you can try to take displacements on the front wheel for x, y, z. and on the rear wheel y, and z. also set to zero displacements all revolute and translation joints . you will add gravity. And run the simulation

    €16 (Avg Bid)
    €16 Ortalama Teklif
    9 teklifler

    I need basic analysis on DNA Eg: ATGCCCCAACTAAATACCGCCGTATGACCCACCATAATTACCCCCATACTCCTGACACTATTTCTCGTCACCCAACTAAAAATATTAAATTCAAATTACCATCTACCCCCCTCACCAAAACCCATAAAAATAAAAAACTACAATAAACCCTGAGAACCAAAATGAACGAAAATCTATTCGCTTCATTCGCTGCCCCCACAATCCTAG

    €5 / hr (Avg Bid)
    €5 / hr Ortalama Teklif
    3 teklifler
    data processing 6 gün left

    I have a data analysis task. I needed someone who can help me with this

    €1966 (Avg Bid)
    €1966 Ortalama Teklif
    13 teklifler

    The design of street lights using solar energy.

    €143 (Avg Bid)
    €143 Ortalama Teklif
    11 teklifler

    This position is responsible for coding, configuration, testing, system performance optimization, and interoperability issues. The Software Developer will work with business product owners, developers, and quality analysts to drive value delivery and will participate in all phases of Agile software development. As a Senior .NET Development Consultant, you will work closely with our clients and tec...

    €13 / hr (Avg Bid)
    €13 / hr Ortalama Teklif
    10 teklifler

    I show you a classification problem where you have a dataframe with 24 features and a target column with 5 categories (0,1,2,3,4) The challenge is: To Do all data analysis at your free election to understand what features could be the best to include in our model to get the higher evaluation metric Select those features that best will perform in our model At your free election do any feature eng...

    €102 (Avg Bid)
    €102 Ortalama Teklif
    6 teklifler

    Use the data to conduct profitability comparative analysis Use software modeling to do linear regression analysis. Need methodology and result discussion

    €68 (Avg Bid)
    €68 Ortalama Teklif
    6 teklifler

    The research gap analysis requires you to study at least fifteen (15) related and recent papers presented at relevant conferences and journals. These should be related to IoT underpinning technologies, tools and models. The objective is to help you to review and evaluate state-of-the-art in IoT [URL'yi görüntülemek için giriş yapın] avenues such as relevant IEEE confere...

    €134 (Avg Bid)
    €134 Ortalama Teklif
    14 teklifler

    1. Logistic regression report, including: - Introduction - Exploratory analysis - From initial to final model - Results - Comments about the data/analysis - Interpretation and conclusions for a lay audience

    €224 (Avg Bid)
    €224 Ortalama Teklif
    20 teklifler

    I have a data analysis actually need a person that will be taking care of my business on my behalf

    €25 / hr (Avg Bid)
    €25 / hr Ortalama Teklif
    14 teklifler

    A SAP expert require ,with extensive training in structures and concrete and long experience in structural analysis. Require some structural summary, report, model, drawings and comprobations.

    €125 (Avg Bid)
    €125 Ortalama Teklif
    5 teklifler

    Greetings My requirement I need some one who will guide me and support me in my current and future online projects Freelancer must possess great skills with good communication + analytical ability , you must provide good ideas to our projects using your skills and experience Nature of the work is : online research 1) the freelancer must have excellent internet research skill a)research on go...

    €50 (Avg Bid)
    €50 Ortalama Teklif
    22 teklifler

    financial and accounting, financial modeling, CFA, CPA, CIMA, stock market analysis, fundamental and technical analysis.

    €14 (Avg Bid)
    €14 Ortalama Teklif
    5 teklifler

    The project is about constructing a glove factory from start to end. Below are the required things to be mentioned: • Introduction: Description of the company, nature of business, list of past awarded projects, etc. • Project details: Description, purpose, duration, location, etc. • Project selection model: Financial model or scoring model in calculation. • Project scope manag...

    €132 (Avg Bid)
    €132 Ortalama Teklif
    4 teklifler

    write a report for these topics : 1- Risk and Sensitivity Analysis 2- Economic Analysis in Public Service Sector the refference will be attached

    €22 (Avg Bid)
    €22 Ortalama Teklif
    25 teklifler

    The aim of research: To investigate and evaluate the frequency and reasons of new diagnosed trauma cases and its association with seasons among my fellow university students Objectives: 1. To investigate frequency of newly diagnosed trauma cases by gender and faculties 2. To evaluate and compare the frequency of newly diagnosed trauma cases by seasons (in the winter and summer) 3. ...

    €81 (Avg Bid)
    €81 Ortalama Teklif
    8 teklifler
    shopify store 6 gün left

    Hello, please no copy paste bid if you can provide the right winning products according to the guide line I mentioned then why not, we can move forward: - 5 Winning Product - Product should not be available nearby and should not be FMCG - Product should not have variations and should have consistent sales graph - Suppliers who can deliver the product in less than 10 days - Video Ads for all pro...

    €408 (Avg Bid)
    €408 Ortalama Teklif
    9 teklifler

    It's small project focused on how to analysis data by using Python.

    €17 (Avg Bid)
    €17 Ortalama Teklif
    23 teklifler

    Greetings My requirement I need some one who will guide me and support me in my current and future online projects Freelancer must possess great skills with good communication + analytical ability , you must provide good ideas to our projects using your skills and experience Nature of the work is : online research 1) the freelancer must have excellent internet research skill a)research on go...

    €49 (Avg Bid)
    €49 Ortalama Teklif
    15 teklifler

    I have a data set that contains hundreds of images. Objectives of this project: (1) Based on the pixel values of the images, I want to cluster these images into several groups using different methods, including 5 traditional clustering methods and 4 deep learning clustering methods: a. Traditional clustering methods: K-means (partitioning based), BIRCH (hierarchical), DBS...

    €139 (Avg Bid)
    €139 Ortalama Teklif
    8 teklifler